texto en 
Inglés (pdf)
Artículo en XML
Referencias del artículo
Traducción automática
Enviar artículo por email
Citado por SciELO 
Similares en
SciELO 
Permalink
The Fusarium genus is a group of phytopathogenic fungi associated to dry and soft rot of several plant species. This genus affects yields and fruit quality because of their ability to synthetize mycotoxins harmful to humans. Some of the mycotoxins biosynthesized by this genus are deoxynivalenol and zearalenones which disturb animal health, including that of humans (Liu et al., 2022). Common toxigenic species are Fusarium sambucinum, F. oxysporum and F. solani (Liu et al., 2022). F. solani is a phytopathogenic fungus liked to plant wilt affecting root and aerial parts, and in many cases, this damage can be observed at first glance (Mejía-Bautista et al., 2016). The presence of F. solani has been recorded in maize (Zea mays), common bean (Phaseolus vulgaris), coriander (Coriandrum sativum), tomato (Solanum lycopersicum), wheat (Triticum aestivum), potato (Solanum tuberosum), avocado (Persea americana) among other crops (Kong et al., 2022). Hass avocado fruit represents an important economic income for Mexico since this country is the main producer and exporter worldwide (Ramos-Aguilar et al., 2021). High fruit requirements by consumers are regarded to its content of vitamins, fiber, reducing sugars proteins, minerals and unsaturated fatty acids accumulated in its pulp (Ramos-Aguilar et al., 2021). Some of these components are exploited by opportunistic microorganisms for their own benefit, causing a collateral decrease in fruit quality (Mejía-Bautista et al., 2016). Fusarium solani is tagged as a phytopathogenic fungus of Hass avocado fruit because of its ability to cause plant wilt (Hernández-Medina et al., 2015). A substantial incidence of this fungus is presented during postharvest period which considerably limits its commercialization (Wanjiku et al., 2020). Although high demand and production of this fruit has increased, losses persists because of diverse biotic and abiotic factors which change its normal physiology (Bowen et al., 2018; Pandey et al., 2021). It has been recorded that wrong fruit management during postharvest period enhances phytosanitary issues (Ramírez-Gil et al., 2021). These problems have turned into increasing crisis because of the non-discriminated use of agrochemicals. In the same context, the excessive use of these substances may induce microbial resistance (Pandey et al., 2021). Due to the latter arguments, considering highly efficient control agents with negligible side effects against environment and public health is desirable. Based in latter points, our research group has focused in the design and application of fungistatic films containing chitosan and essential oils of cinnamon and thyme for the control of diverse pathogens of Hass avocado. These materials efficiently modulated the standard growth of Fusarium verticillioides and Clonostachys rosea in avocado fruits under postharvest conditions (Coyotl-Pérez et al., 2022a; 2022b). Similarly, results on the use of chitosan films impregnated with thyme essential oil reported by Coyotl-Pérez et al. (2022a), indicated that these materials represent a viable alternative for controlling the soft rot raised by C. rosea infection in avocado fruit. Then, the exploration of these films on other pathogens of the same fruit is desirable. As is known, sustainable agriculture faces these problems with the aim of limiting the constant practice of unsafe agents (Eke et al., 2020). Currently, the use of antifungal materials such as chitosan has acquired substantial importance due to their application in postharvest diseases (Yan et al., 2021). However, chitosan is a polymer showing limitations in its antifungal activity and can be ineffective against specific filamentous fungi (Coyotl-Pérez et al., 2022a; 2022b). Then, hybrid materials made with chitosan and essential oils are visualized as an agroecological alternative to reduce fungal diseases during postharvest period (Fernández et al., 2015). On the bases of latter arguments, this work aimed to determine the efficacy of chitosan films impregnated with thyme essential oil on Hass avocado fruits, previously infected with a native strain of Fusarium solani isolated from symptomatic fruits collected in the northern highlands of Puebla, Mexico.
Materials and methods
Isolation and identification of an associated fungus. Fusarium solani was isolated from avocado fruits showing symptoms of soft rot as a consequence of the exploration of associated fungi of Hass avocado isolated from the northern highlands of Puebla which were included in investigations performed by Coyotl-Pérez et al. (2022a; 2022b) during June, 2021 in Yaonáhuac, Puebla, México (19°56′55″ N 97°26′26″ W; 1997 masl). Once isolated, the fungus was kept in potato dextrose agar (PDA). In addition, 1 cm2 PDA microcultures were prepared for the identification and description of fungal reproductive structures. The microcultures were stored at 25 ºC during 5 d in the dark and the structures were observed in a Primo Star Carl Zeiss optic microscope.
Molecular identification. The fungus was identified by genomic DNA extraction using the E.Z.N.A Plant DNA DS Mini Kit (Omega Bio-Tek) and the amplification of molecular markers using the primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) for the obtainment of partial sequence of the internal transcribed spacer of the ribosomal 18S gene (Coyotl-Pérez et al., 2022b). Additionally, the primers EF-1H (ATGGGTAAGGAAGACAAGAC) and EF-2T (GGAAGTACCAGTGATCATGTT) were used to obtain the partial sequence of the translation elongation factor 1-alpha (TEF-1α) (Coyotl-Pérez et al., 2022b). The resulting amplicons were sequenced using commercial services of Macrogen Inc. (Seoul, South Korea). Once obtained, the sequences were compared with those deposited in the database of the National Center for Biotechnology Information (NCBI), through multiple alignments using BLAST software.
Pathogenicity tests. Cultures of 10 days grown in PDA were incubated at 4 °C for 12 h and exposed to solar radiation for 3 h, during three consecutive days. This action was done for stimulating the generation of reproductive structures. Pathogenicity tests were carried out in healthy avocado fruits collected in the same zone of study in accordance with Coyotl-Perez et al. (2022a). The reproductive structures (conidia) were recovered from culture medium with sterile saline solution using a micropipette of 200 µL capacity to be finally adjusted to 10,000 conidia per mL using a Neubauer chamber. A total of 100 conidia were inoculated in each healthy fruit by mechanical penetration with the aim to increase infection rate. The avocados were incubated at room temperature (25 °C), 70% relative humidity and photoperiod of 12 h:12 h light: darkness for 21 days. Symptoms and signs of rot were followed daily during the same period of time.
Phylogenetic analysis. The phylogenetic analysis of the native strain of F. solani was performed as reported by Romero-Arenas et al. (2022), using Clustal X 2.0 software. Multiple alignments were separately done with ITS and EF-1α, respectively. Posteriorly, concatenation (assembly) and generation of phylogenetic tree were both performed with the predictive evolution software MEGA version 11.0.11.
Quantification of in vitro antifungal activity. The essential oil of thyme used in this investigation was extracted according to the protocol previously described by Coyotl-Pérez et al. (2022a). The chemical composition of the essential oil is described in Table 1. The obtainment of minimum inhibitory concentration (MIC) was achieved by microdilution using potato dextrose broth (PDB) in 96 well-plate added with resazurin (1 mM; Sigma-Aldrich Co. St Louis MO) as indicator of cell viability in a final volume of 300 µL. Hyphal discs of 5 mm diameter were placed in each well of the plate at 28 °C for 48 h with different concentrations of thyme essential oil (0.1-6 mg mL-1) emulsified with absolute ethanol. Hyphal discs were obtained from cultures of F. solani of 7 days grown in PDA. At the end of this time, absorbance was recorded at 630 nm using PDB plus resazurin and PDB with resazurin plus hyphal discs as controls to normalize acquired results.
Table 1 Chemical composition of the thyme essential oil used as antifungal agent in the chitosan films evaluated in this investigation. The chemical profile has been previously reported by Coyotl-Pérez et al. (2022a).
| Compound | etention index | Abundance (%) |
|---|---|---|
| Alpha-Pinene | 939 | 2.5 |
| Camphene | 946 | 2.8 |
| Beta-Pinene | 974 | 2.1 |
| Alpha-Phellandrene | 1002 | 0.5 |
| (2E)-Hexenyl acetate | 1010 | 2.9 |
| o-Cymene | 1022 | 15.7 |
| Gamma-Terpinene | 1054 | 12.4 |
| Linalool | 1095 | 1.6 |
| 1-Terpineol | 1130 | 2.4 |
| Camphor | 1141 | 0.5 |
| Borneol | 1165 | 1.4 |
| Alpha-Terpineol | 1186 | 0.3 |
| Thymol, methyl eter | 1232 | 1.7 |
| Thymol | 1289 | 43.6 |
| Beta-Cubebene | 1387 | 3.3 |
| Beta-Elemene | 1389 | 0.5 |
| Beta-Caryophyllene | 1417 | 1.2 |
| Total | 95.4 |
To obtain MIC, twenty replicates (n=20) were considered for each point of the dose-response curve and the percentage of inhibition was calculated based in the following formula:
Where:
Abs: Absorbance value at 630 nm
EO: Essential oil
Film elaboration and physicochemical characterization. Films were obtained according to the methodology reported by Coyotl-Pérez et al. (2022a; 2022b) using high molecular weight chitosan from Sigma-Aldrich Co. (St. Louis, MO, USA) with slight modifications. Three concentrations of thyme essential oil (0.7, 1.0 y 1.3% w/v) were mixed with 0.1 L chitosan solution (1% w/v) under constant stirring at 50 ºC for 1.5 h. Twenty milliliters of this solution were spread into Petri dishes of 9 cm diameter to be dehydrated at 25 ºC in a glass desiccator containing silica gel for 5 d. The films were manually scratched out from the Petri dish and named FT1, FT2 y FT3 according to their increasing oil concentration order. Posteriorly, the films were subjected to physicochemical analysis and biological assessment in accordance with Coyotl-Pérez et al. (2022a) and Morales-Rabanales et al. (2022). The physicochemical characterization included transmittance and opacity degree by UV-Vis spectrophotometry as well as texture by scanning electron microscopy (SEM) using a JEOL JSM-6610 apparatus (Akishima, Kanto, Japón). Conditions for SEM were those reported by Morales-Rabanales et al. (2022). On the other hand, width of each film was measured (n=10) using a digital micrometer iGaging with 0.001 mm precision. Transmittance and opacity were associated to width and absorbance according to the same authors (Morales-Rabanales et al., 2022). Biological tests with obtained materials are described in the next section.
Fungistatic activity of chitosan films and thyme essential oil. Healthy fruits collected from the zone of study were transported to the laboratory to be sanitized by immersion in a 20% sodium hypochlorite solution for 1 h and posteriorly rinsed with sterile distilled water. Twenty-five avocados (n=25) were used for each treatment and these were inoculated in a single point of the fruit with 100 conidia dissolved in saline solution (20 µL) using a micropipette of 20 µL capacity. Posteriorly, the fruits were covered with a specific film (FT1-FT3). The amount of conidia in the solution was calculated using a Neubauer chamber. Control groups consisted of infected avocados without film (control of infection), healthy avocados without film (control of non-infection) and, avocados covered with films of pure chitosan without essential oil. Experimental groups were incubated at 25 °C and 70% relative humidity under photoperiod of 12 h light and 12 h darkness during 21 days and symptom and sign appearance such as loss of turgor and mycelium emergence were documented during 21 d. Simultaneously, in situ evaluation was done over film surface using 1 cm2 squares added with 100 viable conidia diluted in a final volume of 10 µL. PDA (1 cm2) was used as a control of conidial germination which was inoculated with the same amount of cells. The films were incubated at 25 °C and relative humidity of 70% under photoperiod of 12 h light and 12 h darkness for 7 d. At the end of this period, the materials were observed under optic microscope to endorse mycelium emergence. Treatments with presence of mycelium were re-isolated and maintained in PDA to corroborate F. solani identity.
Quality parameters analysis. Firmness was the first quality parameter in accordance with Coyotl-Pérez et al. (2022a). Additionally, the nutritional composition (protein, reducing sugars, fat and fiber) was determined through the reported methodology of AOAC (2019). Complementarily, the levels of linoleic acid (18:2 n-6), oleic acid (18:1 n-9), palmitic acid (16:0) and palmitoleic acid (16:1) were estimated as nutraceutical parameters of the fruit (Coyotl-Pérez et al., 2022a).
Statistical analysis. Data from treatments processed by Analysis of Variance coupled to Tukey Tests (p < 0.01) using GraphPad Prism software version 8.0.1.
Results and discussion
Identification and characterization. Morphologically, the isolated strain showed withe color in the obverse of the Petri dish and cream color at the back of the same dish (Figure 1A and 1B). It showed filamentous border, cotton texture, smooth consistence and moderate radial growth (4-7 d). Macroconidia were erect, slightly curved with thin walls. Apical cells were curved and septate from which non-branched phialides emerged. The length of macroconida was from 20 to 40 μm, these were thin, slightly curved and every macroconidium showed the presence of septa (Figure 1C). The length of microconida was from 5.96 to 10.3 μm (Figure 1D). These morphological features were consistent with those described by Wanjiku et al. (2020) and Dugassa et al. (2021) for Fusarium solani.
Figure 1 Morphology of Fusariun solani. A) Radial growth observed from the obverse of Petri dish in PDA after 7 days. B) Radial growth observed from the reverse of Petri dish. C) Macroconida observed at 50X without staining. D) Microconidia observed at 50X stained with cotton blue.
Molecular analysis revealed that the coding sequence for the internal transcribed spacer had a homology of 98.8% with that of sequence MN523174.1 of Fusarium solani reported by Rivedal et al. (2020). The sequence was deposited at the gene bank of NCBI with the accession code OR016146. On the other hand, the sequence of 682 bp corresponding to the translation elongation factor 1-alpha, had a homology of 97.7% with the sequence HM852038.1 of Fusarium solani reported by Scheel et al. (2013).
Phylogenetic analysis. The evolutionary history was inferred by the Neighbor-Joining method, which allowed to predict the phylogeny of Fusarium solani showing the sum of branch length equal to 0.23497162 (Figure 2). The percentage of replicates was grouped in the starting test (1000 permutations) with a scale of 0.020 from the concatenation of ITS and EF-1α sequences. This analysis involved 12 nucleotide sequences and the model avoided alignment gaps with a total of 1014 positions in the final dataset. Such sequences were chosen in the basis of percentage of homology with obtained sequences of the F. solani strain isolated in the present investigation.
Figure 2 Phylogenetic tree of Fusarium solani with concatenated sequences of ITS and EF-1α. The strain F. solani isolated from the northeast highland of Puebla is remarked in bold font.
The concatenated sequences belonged to the accessions described in Table 2. Most homologue to that of F. solani were those isolated from Panax ginseng from China.
Table 2 Genic sequences extracted from the National Center for Biotechnology Information database to estimate phylogenetic relationships.
| Species | Strain | Source | Country | Accesion ITS/TEF-1α | |
|---|---|---|---|---|---|
| Fusarum solani | FS07-1 | Panax ginseng | China | MN636714.1 | MN650117.1 |
| F. solani | DH01-3 | Ginseng (root) | China | MN637839.1 | MN650105.1 |
| F. solani | TH05-2 | Ginseng (root) | China | MN637848.1 | MN652892.1 |
| F. solani | LH10-6 | Oryza sativa | China | MK611942.1 | MN927129.1 |
| F. solani | F56 | Lilium longiflorum | Estados Unidos | HQ379676.1 | KY020039.1 |
| F. solani | FPOST-174 | Strawberry | España | KY484986.1 | KX215054.1 |
| F. solani | HB-ZB-F06-14 | Beet | China | KT213074.1 | KT213256.1 |
| F. solani | DE20 | Mangrove soil | Malasia | KF897899.1 | KM580560.1 |
| F. solani | TH07-2 | Ginseng (root) | China | MN637851.1 | MN652894.1 |
| F. solani | NW-FVA_3177 | Fraxinus excelsior | Alemania | MH191237.1 | MH220421.1 |
| Neocosmospora perseae | CPC:26833 | Persea americana | Italia | LT991944.1 | LT991906.1 |
| F. solani | MA-W2 | Persea americana | Mexico | OR016146 | TEF submitted |
Assays of antimicrobial evaluation by broth microdilution. The results of the present study showed that thyme essential oil exerted a MIC of 4.4 ± 0.04 mg mL-1 on F. solani. It is known that essential oils work as natural antifungal agents which additionally are environmentally friendly, renewable and easily biodegradable for the conservation of several foods (Pandey et al., 2017). The mechanism of action of essential oils is conferred to the destabilization of fungal and bacterial cells walls and membranes (Pacheco-Hernández et al., 2020). As a consequence, intracellular compounds drain causing cell death by lysis (Eke et al., 2020). It has been reported the antimicrobial action of the methanolic extracts of Artemisia annua (Zaker, 2014) and Larrea tridentata (Rodríguez-Castro et al., 2020) against Fusarium solani with percentages of inhibition over 50% at 5 mg mL-1. Coyotl-Pérez et al. (2022a) reported that the concentration of thyme essential oil with more effectiveness against Clonostachys rosea was 2.13 mg mL−1, this concentration was lower than that reported in the present study. Interestingly, the essential oil used in this study had the same chemical composition than that reported for the same authors with thymol (43.6%), O-cimene (15.7%) and gamma-terpinene (12.4%) as major compounds (Coyotl-Pérez et al., 2022a).
Physicochemical characterization of films. The microstructure obtained by scanning electron microscopy (SEM) revealed that film surface of the chitosan hybrid films obtained in this work was homogenous as those reported to inhibit the growth of C. rosea in avocado fruit (Coyotl-Pérez et al., 2022a). The presence of pores, bubbles or fractures was not observed (Figure 3), which indicated high miscibility between polymeric matrix and the essential oil. However, small irregularities were observed in transversal views (Figure 3) but, these did not interfere with their malleability. The addition of essential oils in polymeric matrices requires emulsification and as a result, the dried material does not show signs of lipid accumulation in the surface (Lian et al., 2020; Ardjoum et al., 2023).The same behavior has been observed in other films impregnated with essential oil of clove (Syzygium aromaticum), citronella (Pelargonium citrodorum) and thyme (Thymus vulgaris) (Haghighi et al., 2019). According to previous studies, the surface of a great variety of hybrid films is often uniform without bubbles, drops, pores or fractures (Haghighi et al., 2019). Contrastingly, the materials generated in this investigation showed small pores revealed in transversal views, especially in films containing the highest concentration of thyme essential oil such as FT2 and FT3 (Figure 3). These pores may be produced by the volatility of the essential oil during drying process (Lauriano et al., 2017).
Figure 3 Micrographs of scanning electron microscopy for transversal views and surfaces of films elaborated with chitosan and hybrids films supplemented with thyme essential oil (FT1-FT3).
The observed transmittance for chitosan films containing 0.7% thyme essential oil showed a similar behavior than that of films made with pure chitosan (Figure 4A). The UV transmittance (190-300 nm) and visible light (350-800) was similar for chitosan films and FT1 films with no statistically significant differences. However, statistically significant differences were observed (p < 0.01) between films FT2 and FT3 with those made with pure chitosan and FT1 from 400 to1000 nm (Figure 5). On the contrary, opacity of films FT2 and FT3 showed a clear protective effect against UV light with statistically significant differences (p < 0.01) in comparison with other films (Figure 4B). In the same context, films made with sole chitosan and FT1 did not show statistically significant differences among them. On the other hand, the thickness of films proportionally increased as the concentration of impregnated essential oil also increased, this trend was in accordance with previous studies performed by Coyotl-Pérez et al. (2022a). The thickness of films FT1, FT2 y FT3 was 0.103, 0.208, 0.223 y 0.251 mm respectively, which was reproducible with previous work describing the same type of films (Coyotl-Pérez et al., 2022a). Lian et al. (2020) created films with diverse polymers (xanthan gum, pullulan, gum tragacanth and gum arabic) supplemented with thyme essential oil for the growth control of E. coli in nectarine. Such films also showed an increase in thickness after adding growing concentrations of essential oil. Nevertheless, some studies suggest that the thickness of films supplemented with essential oils is associated with changes in hydrogen bonds as well as with the ionization of amine and carboxylic groups (Lian et al., 2020). As is known, opacity and transmittance act as barriers against UV radiation which induces fast food degradation. High levels of opacity and low transmittance play a vital role to preserve organoleptic properties and to retard lipid oxidation (Romanazzi et al., 2017). The capacity to retract UV light is an important factor to conserve foods since such radiation causes a fast degradation because of associated oxidative stress (Romanazzi et al., 2017).
Figure 4 Transmittance (A) and opacity (B) of chitosan films (without essential oil) and films impregnated with thyme essential oil at concentration of 0.7 (FT1), 1.0 (FT2) and 1.3 % w/v (FT3). Different letters indicate statistically significant differences (p < 0.01) according to ANOVA-Tukey (n=5).
Figure 5 Qualitative kinetics for the colonization of Fusarium solani in avocado fruits treated with chitosan films and films impregnated with thyme essential oil at concentrations of 0.7 (FT1), 1.0 (FT2) y 1.3% w/v (FT3) during 21 days.
In situ evaluation of chitosan films impregnated with thyme essential oil. From the four films evaluated, those made by pure chitosan did not exert and inhibitory effect on the growth of F. solani. A similar result was observed the Hass avocado fruits infected with Clonostachys rosea and Fusarium verticillioides (Coyotl-Pérez et al., 2022a; 2022b). On the other hand, the films FT2 and FT3 showed a clear delay on the growth of F. solani until 21 days after treatment (Figure 5). The addition of thyme essential oil to chitosan matrix enhanced the antimicrobial effect, this according to previous results observed in films generated with maize starch on Escherichia coli and Listeria monocytogenes (Ardjoum et al., 2023). It has been demonstrated that pectin coatings impregnated with essential oils reduced the amount of microorganisms (lactic bacteria, yeasts and filamentous fungi) in foods of animal origin such as bologna (Gedikoğlu, 2022). In other context, essential oils rich in carvacrol and thymol has been used to improve shelf life of avocado fruit during post-harvest period. These essential oils were extracted from Thymus daenensis and Satureja khuzistanica and showed high effectiveness against anthracnose (Colletotrichum gloeosporioides) (Sarkhosh et al., 2017).
Avocado fruits treated with hybrid films did not show symptoms of infection whereas non-treated infected fruits were clearly affected since the first three days (Figure 6A). On the other hand, infected avocados simultaneously treated with films made with pure chitosan and FT1 showed symptom of infection from the 5th day (Figure 6A). These results suggested that chitosan itself cannot stop the growth of F. solani. Despite this, it has been documented that chitosan damages cell wall and changes cell membrane permeability of filamentous fungi (Romanazzi et al., 2017). The evaluation of conidial germination on the surface of films FT1-FT3 demonstrated an evident viability loss, suggesting that coatings with higher amount of thyme essential oil are more effective to be preferentially used as preventive agents (Figure 6B). The results of this investigation suggested that thyme essential oil impregnated in chitosan films causes a substantial delay in the growth of F. solani at least for 21 days. However, residual protective effect may be extended to 30 days in accordance with documented observations (data no shown).
Figure 6 Kinetics for symptom appearance during in situ inoculation of Fusarium solani on avocado fruits (A). Evaluation of conidial viability of F. solani on the surface of films FT1-FT3 (B). Means (n=25) with different letter indicate statistically significant differences (p < 0.01) by ANOVA-Tukey.
Firmness of avocado fruits. The firmness of non-treated avocado fruits was notably reduced (69.5%) en 21días. At the same time, healthy avocados showed loss of turgor 19.5 al 26.6% (Figure 7). The films FT1, FT2 and FT3 kept the firmness of avocado fruits (p < 0.01) until days 21 compared with both healthy and infected avocados. Thymol (as major volatile in thyme essential oil) is a phenolic monoterpene which causes physical damage changing permeability of cell membrane (Sarkhosh et al., 2017). The results of statistical analysis revealed statistically significant differences (p < 0.01) between the firmness of healthy avocados and those covered with the films FT2 y FT3. Thus, avocados treated with films made with pure chitosan showed 13% loss related with healthy non-treated avocados. These evidences suggested that chitosan does not exert a prolonged fungistatic activity on F. solani. It has been reported that the application of the essential oils from thyme and savory (Satureja montana) keep the firmness of avocado fruits better than those of mentha (Mentha piperita), cinnamon (Cinnamomum verum) or lavender (Lavandula angustifolia) during storage (Sarkhosh et al., 2017). Previous studies performed by our research group, indicates that loss of firmness in avocado fruit harvested in the northeastern highlands of Puebla, is mainly affected by Clonostachys rosea (Coyotl-Pérez et al., 2022a; 2022b). The loss of firmness can be attributed to the degradation of cell wall components (pectins) by the action of fungal pectinesterases and polygalacturonases (Huber et al., 2001). Loss of turgor was translated into water deficit in plant tissues causing changes in vegetal texture (Bello et al., 2016). Firmness is a very important parameter in the quality of perishable fruits and new techniques for their conservation represent an area of opportunity that must be addressed with special interest (Jha et al., 2012; Pedreschi et al., 2019).
Figure 7 Firmness of avocado fruits treated with hybrid films FT1-FT3. Means with divergent letters indicate statistically significant differences (p < 0.01) by ANOVA-Tukey (n=25).
Parameters of nutritional and nutraceutical quality. Avocados infected with F. solani showed a dramatic reduction in the content of fat (1.36 ± 0.4 g/100 g) at day 21 compared with healthy fruits (Figure 8). On the contrary, avocados treated with films FT2 y FT3 presented marked differences at day 21 (p < 0.01) compared with infected fruits. However, fruits treated with films made with pure chitosan and FT1 did not show statistically significant differences in relation to infected fruits but, they showed differences with healthy fruits. Regarding the content of total fat, infected avocados had 60% reduction at day 21 in comparison with healthy fruits. Similarly, protein levels showed 49% decrease in avocados infected by F. solani at day 21 in comparison with healthy avocados (p < 0.01). It was also observed that infected fruits and those treated with films made of pure chitosan and FT1 did not show statistically significant differences (p < 0.01) among them at day 21. However, avocados treated with film FT3 showed statistically significant differences (p < 0.01) in comparison with healthy and infected avocados. On the other hand, avocados treated with films FT2 and FT3 preserved up to 37% protein content at day 21 compared to healthy fruits. Contrarily, reducing sugars decreased up to 90% in infected fruits at day 21 compared with healthy fruits. This fact may be related with the parasitic activity of the filamentous fungi which uses reducing sugars as a carbon source. In addition, infected avocados previously treated with films FT2-FT3 showed statistically significant differences at day 21 if compared with healthy avocados (p < 0.01). In the same context, fiber content was reduced until 90% in infected avocados at day 21 in comparison with healthy fruits. Treatments of pure chitosan and FT1 showed statistically significant differences (p < 0.01) at day 21 compared with healthy avocados since losses of 70 y 21%, were respectively recorded. Treatments FT2 and FT3 efficiently maintained fiber content but, no statistically significant differences (p < 0.01) were observed among these treatments and healthy avocados.
Figure 8 Fat content, protein, reducing sugars and fiber of Hass avocado fruits treated with hybrid films impregnated with thyme essential oil at concentrations of 0.7 (FT1), 1.0 (FT2) y 1.3% w/v (FT3) during 21 days. Asterisks indicate means (n=25) with statistically significant differences by ANOVA-Tukey (p < 0.01).
Avocado fruit contains nutrients that favor human diet because of the high amount of protein (4%), but especially it is pretty valued because of the high amount of beneficial fat (30%) (Selladurai y Madhav, 2020). Thus, fatty acid content plays a crucial role to ameliorate the risk of cardiovascular diseases (Krumreich et al., 2018).
The decrease in reducing sugar content was inversely proportional to the accumulation of fatty acids. This evidence could be related to the overexpression of genes associated to glycolysis as a potential source of pyruvate for fatty acid biosynthesis through the excretion of citrate to the cytoplasm (Pedreschi et al., 2019). Determination of linoleic acid in infected fruits revealed that F. solani was able to drastically decrease its accumulation at day 21 in comparison with healthy fruits (Figure 9). Such decrease was evident in infected avocados during normal ripening and suggested that F. solani is able to metabolize fatty acids as a substrate for its development (Pedreschi et al. 2019; Bowen et al., 2018). Contrarily, avocados treated with films FT3 showed statistically significant differences at day 21 (p < 0.01) in comparison with healthy fruits. Infected fruits and those treated with films made of pure chitosan did not show statistically significant differences among them but, they show differences with healthy fruits at day 21. The content of oleic acid in infected fruits has a reduction of 70% at day 21 showing statistically significant differences (p < 0.01). Villa et al. (2011) reported oleic acid as the main fatty acid in Hass avocado with rates of 67-70% of total lipid composition. These authors observed a significant increase of monounsaturated and saturated fatty acids during normal avocado ripening. Contrarily, these authors concluded that polyunsaturated fatty acids decreased. Infected avocados treated with chitosan films showed statistically significant differences compared with healthy avocados at day 21. Nevertheless, avocados treated with films FT3 did not show statistically significant differences (p < 0.01) compared with healthy avocados at day 21.
Figure 9 Contents of linoleic acid, oleic acid, palmitic acid and palmitoleic acid in Hass avocado fruits treated with hybrid films impregnated with thyme essential oil at concentrations of 0.7 (FT1), 1.0 (FT2) and 1.3% w/v (FT3) during 21 days. Asterisks indicate means with statistically significant differences by ANOVA-Tukey (p < 0.01).
Conversely, palmitic acid decreased 63.5% in infected fruits whereas avocados treated with chitosan films presented statistically significant differences in comparison with healthy avocados (p < 0.01). In the same context, avocados treated with films FT1 and FT2 showed statistically significant differences compared with healthy fruits because of their ability to preserve the content of this fatty acid in around 37.1 y 40%. Finally, the content of palmitoleic acid in infected fruits decreased until 67.6% in comparison with healthy fruits. Treatments of pure chitosan and FT1 showed statistically significant differences (p < 0.01) at day 21 in comparison with healthy for this fatty acid, whereas treatments FT2 and FT3 kept the content of palmitoleic acid without statistically significant differences with healthy avocados. Pedreschi et al. (2019) claim that the concentration of palmitic and palmitoleic acids in avocados usually increases between 65 day 105 days in intact plants. The results of this investigation suggest that during a period of 21 days, the levels of these fatty acids remain steady, however, longer time is required to corroborate the findings of Pedreschi et al. (2019).
Conclusions
The films generated in this investigation showed fungistatic activity against a native strain of Fusarium solani isolated from Hass avocado fruits harvested in the northeastern highlands of Puebla. The addition of thyme essential oil in chitosan films improved physicochemical and biological properties in these films. Remarkably, the films made of pure chitosan did not stop the normal growth of the fungus under the experimental conditions reported in this work. It was observed that transmittance and opacity were substantially improved by the addition of thyme essential oil. The fungistatic films obtained in this investigation delayed the normal growth of the fungus and preserved nutrimental and nutraceutical contents of Hass avocado fruit up to 21 days. These results suggested the possible use of these films in avocado fruits to reduce the incidence of F. solani during postharvest period.
