Introduction

In Mexico, Fusarium species associated with carnation have been characterized morphologically in Morelos, State of Mexico and the Federal District (^{Martínez, 2008}). In the state of Baja California, which in recent years has become one of the leading carnation exporters to the United States of America (^{Luque and Osuna, 2011}), there are no reports on this fungus. Morphological characterization is primarily based on shape, size and presence/absence of asexual reproduction structures in different culture media (^{Leslie and Summerell, 2006}). Molecular characterization is performed using various DNA-based methods, such as sequencing conserved regions, among which the gene encoding translation elongation factor 1α (EF1α) has been very useful in sequence analysis for phylogenetic and taxonomic studies (^{Geiser et al., 2004} ). This study aimed at morphological and molecular identification of Fusarium spp. strains isolated from plants with wilt symptoms.

Collections were made in eighteen carnation cultivars with wilt symptoms at the Ensenada and Playas de Rosarito municipalities, Baja California, Mexico, from September to December 2011. For strain isolation from crown and stem, soil residues were removed in tap water, symptomatic tissue pieces were cut, disinfected and plated on Potato Dextrose Agar (PDA, Difco®) culture medium supplemented with chloramphenicol (15 µg/ml). Plates were incubated at 25 ± 2 °C in total darkness. Monoconidials cultures were obtained from all strains.

For morphological characterization, strains were grown on Carnation Leaf Agar (CLA), Spezieller Náhrstoffarmer Agar (SNA) and PDA. Morphology, colony pigmentation and sporodochia and sclerotia production were analyzed on PDA media. Colonies were photographed with a SLR Nikon D3000 camera. Sporodochia and sclerotia were observed under an Olympus SZ X 12 stereomicroscope and photographs were taken with a DP70 camera. Shape, size and presence of macroconidia, microconidia, chlamydospores and conidiogenic cells were analyzed on CLA and SNA media, images were taken and edited using an optical Axiovert 200 Zeiss® inverted microscope, with phase contrast microscopy.

For molecular characterization, DNA was extracted from strains with the DNeasy Plant Mini Kit (Qiagen^®) and the translation elongation factor 1α (EF1α) was amplified by PCR. For amplification, the oligonucleotides EF1-728: 5' CATCGAGAAGTTCGAGAAGG 3' (^{Carbone and Kohn, 1999}) and EF2: 5' GGA(G/A)GTACCAGT(G/C) ATCATGTT 3' (^{O'Donnell et al, 1998}) were used at 50 pmol, 50 ng genomic DNA, 1.25 U Taq DNA polymerase (Fermentas), 2.5 µl Buffer 10X Master Amp™ PCR Enhancer with betaine (Epicentre® Biotechnologies), 0.5 µl dNTPs (20 mM), 4 µl MgCl2 (25 mM) and sterile distilled water to complete 25 µl. The program used was: initial denaturation for 4 min at 95 °C, 35 cycles of 1 min each of denaturation at 95 °C, annealing at 50 °C and extension at 72 °C and a final extension of 10 min at 72 °C.

The amplified fragments were purified using the QIAquick^® kit (Qiagen®) and were sequenced at the Clemson University Genomics Institute, South Carolina, United States of America. For sequence analysis, the Genbank database from the ^{National Center for Biotechnology Information (http://www.ncbi. nlm.nih.gov)} and the ^{Fusarium-ID database (http://isolate.fusariumdb.org)} were searched. The query sequences were compared using the BLAST algorithm (Basic Local Alignment Search Tool). Sequences showing high similarity to the analyzed strains were retrieved and edited with EditSeq (Lasergene, DNAstar, Inc., Madison, WI, USA). Multiple alignment was performed using the ClustalW method and a phylogenetic tree was generated using the MegAlign software (Lasergene, DNAstar, Inc., Madison, WI, USA). Finally, to conclude the identification for each isolate, the results of morphological and molecular characterization were analyzed together.

Forty-two Fusarium spp., strains were obtained, twenty-two isolated from crown and twenty from stem. Based on the morphological characteristics analyzed, the following species were identified: Fusarium oxysporum, F. proliferatum, F. solani, F. tricinctum, F. globosum, F.incarnatum y F. equiseti (Figure 1). Phylogenetic analysis using EF1α sequences confirmed the species identity (Figure 2).

Figure 1 Fusarium spp. isolated from carnation plants with wilt symptoms. A) F. oxysporum; B) F. proliferatum; C) F. solani; D) F. tricinctum; E) F. globosum; F) F. incarnatum; y G) F. equiseti. ma=macroconidium; mi= microconidium; me= mesoconidium; cc= conidiogenic cell; cl= chlamidospore; ep=sporodochium; ec= sclerotium. Scale bar= 10 µm. 

Figure 2 Phylogenetic tree constructed using Clustal W method with the MegAlign software (Lasergene, DNAstar, Inc., Madison, WI, USA). This tree contains sequences generated with the EF1-728/EF2 oligonucleotides. Strains isolated from different carnation cultivars are shown in bold. Species beginning with accession numbers starting as'FD_' belong to the ^FUSARIUM-ID database, the other species are deposited in the NCBI. 

Fifty percent of the isolated strains corresponded to the F. oxysporum species and was found associated with Delphi, Nelson, Pink Nelson, Raggio di sole, Bright Rendez Vous, Vesuvio, Tabor, Fushia, Miniblanca and Rosita cultivars. Phylogenetically, these strains showed the highest homology with strains reported in carnation in Israel, Italy, Australia and Spain. Within the F. oxysporum species several special forms and pathogenic races have been described, which are host- and cultivar-specific respectively, in this study intraspecific morphological differences were observed in colony pigmentation and appearance, in macroconidia and microconidia abundance and monophialides size, thus there is probably more than one special form and perhaps more than one pathogenic race.

The F. proliferatum species was found in three isolates from the crown and four from stem in Euforia, Chateau, Nelson, Miniblanca, Arevalo and Pink Nelson cultivars.

Phylogenetically this species showed homology with strains in crops from the Allium genus (Italy and Uruguay), chickpea (India), and insects (USA/ The F. proliferatum species has been reported as co-isolate in carnations with crown rot, but it is considered a saprophytic species (^{Manicom and Baayen, 1993}).

The F. solani species was identified in five isolates from crown and three from stem in Nelson, Pink Nelson, Lion King, Rendez Vous and Cherry tessino cultivars. Phylogenetically, most showed high homology with Fusarium solani strains from the United States, reported in maize, insects and humans, and with one strain associated with custard apple in Pakistan. The F. solani species contains pathogenic strains affecting economically important crops such as potato, avocado, citrus, orchids, legumes, tropical plants, among others, but there are also non-pathogenic strains which have even been used for biological control of tomato wilt (^{Larkin and Fravel, 2002}). Therefore, it is considered appropriate to assess its effect on carnation.

F. tricinctum was isolated from crown and stem from a plant of the Delphi cultivar. Phylogenetically, the strains showed high homology with the F. tricinctum species of Japanese origin (AB674264). These were the only strains producing red pigments on top and bottom of the colony on PDA medium. F. tricinctum was reported in the United States of America by ^{Nelson et al. (1975)} and in Australia by ^{Wright et al. (1997)} as the causative agent of bud rot in carnation crops. Until now, in Mexico, there were no reports on this species and although F. tricinctum was isolated only from the Delphi cultivar, in this work its presence is reported and pathogenicity tests and isolation from buds are suggested.

The only F. globosum strain obtained was isolated from the crown of the Mixed cultivar. This species was first isolated from maize in South Africa, subsequently isolated from wheat in Japan. Multiple molecular analyses have been performed and it was found that despite morphological similarities, fungi isolated from both countries exhibit multiple biological differences (^{Moses et al., 2010}). In Mexico, this species had not been reported, therefore it is reported for the first time in this work, associated with carnation.

The F. incarnarum and F. equiseti species were identified in Vega and Delphi cultivars, respectively. Phylogenetically the F. incarnarum strain showed high homology with one from rice in Spain and F. equiseti with a strain from Germany. The F. incarnatum and F. equiseti species are closely related morphologically and molecularly. Both produce brown spots on the bottom of the colony on PDA, but differ by the presence of microconidia in F. incarnatum. Both species have been reported mainly as saprophytes, (^{Leslie and Summerell, 2006}), however F. equiseti is a root colonizing fungus which reduces or prevents mycorrhizal association with roots (^{McAllister et al., 1997}) and F. semitectum (synonym of F. incarnatum) has also been associated with an infection caused by different fungi in dragon fruit (Hylocereus polyrhizus) in Malaysia (^{Hawa et al., 2010}).

Conclusions

Species associated with different carnation cultivars with wilt and stem rot symptoms identified in this study were: F. oxysporum, F. solani, F. proliferatum, F. tricinctum, F. globosum, F.incarnatum and F. equiseti. The F. tricinctum, F. globosum and F. solani species are reported in Mexico for the first time associated with carnation wilt symptoms. The highest number of isolated strains corresponded to the F. oxysporum species, with slight morphological and phylogenetic differences quite possibly due to the presence of different special forms and pathogenic races that are currently being evaluated.