Artículo original

 

Study of cutaneous leishmaniasis in the State of Campeche (Yucatan Peninsula), Mexico, over a period of two years

 

Estudio de la leishmaniasis cutánea en el estado de Campeche (Península de Yucatán), México, por un periodo de dos años

 

Mirsha Pamela Hernández-Rivera, MSc,⁽¹⁾ Omar Hernández-Montes, PhD,⁽¹⁾ Adelaido Chiñas-Pérez, MC,⁽²⁾ Juan Miguel Batiza-Avelar, Prof. Antrop. Social,⁽²⁾ Gustavo Sánchez-Tejeda, MSP,⁽³⁾ Carlos Wong-Ramírez, PhD,⁽¹⁾ Amalia Monroy-Ostria, PhD.⁽¹⁾

 

(1) Escuela Nacional de Ciencias Biologicas, Instituto Politécnico Nacional. México DF, Mexico.

(2) H. Ayuntamiento de Calakmul. Campeche, México.

(3) Secretaría de Salud. México

 

Corresponding author

 

---

Abstract

Objective. To study cutaneous leishmaniasis (CL), in the Calakmul municipality of the Campeche State, during two years.

Materials and methods. Individuals with skin lesions were evaluated. Aspirates taken from the lesions were cultured, PCR was performed to diagnose the Leishmania species.

Results. The culture detected 42% of the samples. PCR diagnosed CL in 76% of the samples; of those 38% were from children and 62% from adults. 89% of the patients were infected with L. mexicana; 14.4% with Mexican strains of L. mexicana; 7% with L. braziliensis; 3.6% with L. mexicana and L. braziliensis. The most affected villages with CL were Dos Lagunas Sur with 12.3%, La Mancolona with 6.5% and La Guadalupe with 2.2% of prevalence, respectively. After the treatment with Glucantime, 96% of the patients were healed.

Conclusion. CL is an important public health concern in Calakmul, and the parasite causing it belongs to Leishmania mexicana and Leishmania braziliensis complexes.

Key words: American cutaneous leishmaniasis; Campeche, Mexico.

---

Resumen

Objetivo. Estudiar la leishmaniasis cutánea en Calakmul, Campeche, México, durante dos años.

Material y métodos. Se estudiaron individuos con lesiones cutáneas, se tomaron aspirados y se inocularon medios de cultivo; se realizó la técnica de PCR para identificar la especie de Leishmania.

Resultados. Los cultivos detectaron 42% de las muestras. Con la PCR se amplificaron 76% de las muestras, 38% fueron tomadas de niños y 62% de adultos. En 89% de las muestras positivas se identificó Leishmania mexicana, en 14.4% cepas mexicanas de L. mexicana, en 7% L. braziliensis y en 3.6% L. mexicana y L. braziliensis. En Dos Lagunas Sur se encontró una prevalencia de 12.3%, en La Mancolona 6.5% y en La Virgen 2.2%. Del total de los pacientes, 96% se curó con Glucantime.

Conclusion. La leishmaniasis cutánea es un problema de salud pública en Calakmul y las especies causantes pertenecen a los complejos Leishmania mexicana y Leishmania braziliensis.

Palabras clave: leishmaniasis cutánea americana; Campeche, México.

---

 

Leishmaniasis is caused by the protozoa Leishmania sp., which is transmitted to human beings and animal reservoirs by phlebotomine sand flies of the genus Phlebotomus (Old World) and Lutzomyia (New World). The World Health Organization (WHO) estimates the worldwide prevalence of leishmaniasis to be approximately 12 million cases, with annual mortality reaching 20 000-30 000. Leishmaniasis has a worldwide distribution and is present on four continents in 88 countries, where the size of the population at risk is about 310 million.^1,2 More than 20 species of Leishmania are capable of causing a wide spectrum of clinical manifestations, ranging from the cutaneous (CL) to the visceral form (VL).^2,3 VL is fatal if left untreated; it is highly endemic in the Indian subcontinent and in East Africa. An estimated 200 000 to 400 000 new cases of VL occur worldwide each year.¹

Cutaneous leishmaniasis (CL) is the most widespread clinical form of the disease. It is presented as a spectrum of clinical manifestations, such as primary localized skin lesions with frequent findings of amastigotes (LCL) that can self-heal usually in individuals with an effective immune response. However amastigotes parasites can disseminate from the skin lesions to the nasopharyngeal mucosa and cause secondary wounds with progressive destruction of mucosal and submucosal tissues, with rare findings of amastigotes typical lesions of mucocutaneous leishmaniasis (MCL), or disseminate to the entire body as nodular lesions usually full of parasites (DCL).⁴

About 95% of CL cases occur in the Americas, the Mediterranean basin, and the Middle East and Central Asia. An estimated 0.7 million to 1.3 million new cases occur worldwide annually.¹

American cutaneous leishmaniasis includes LCL and DCL caused by Leishmania mexicana complex members of subgenera Leishmania and MCL caused by members of the Leishmania braziliensis complex of the subgenera Viannia.² It is endemic to 21 countries where about 39 million individuals are considered to be at risk of acquiring the disease. In endemic regions, multiple species of Leishmania may co-exist.⁵ Natural Leishmania infections are found in humans and other mammal reservoir hosts (mainly marsupials, rodents, edentates, and carnivores).^2,6

In Mexico, CL is the most wide spread form of leishmaniasis. It is distributed in several states, with the main endemic areas located in the southeast of the country. LCL, also known as "chiclero's ulcer" in southeastern Mexico, was described by Seidelin in the sylvatic region of the Yucatan peninsula.⁷ In this area, the state of Campeche is affected by the LCL and MCL clinical forms; the Leishmania species involved are members of the L. mexicana and L. braziliensis complexes.^{5, 8-10}

Therefore, early differential diagnosis of CL and the identification of the Leishmania strains are important for monitoring clinical outcome and adequately targeting treatment. Furthermore, diseases with other causes but with a clinical manifestation similar to that of leishmaniasis (e.g., leprosy, skin cancers, tuberculosis, cutaneous mycoses) are common in these leishmaniasis endemic areas. Molecular diagnosis for cutaneous leishmaniasis has been extensively developed, essentially by PCR-based methods. Kumar¹¹ reported that kDNA PCR had 96.6% of sensitivity for detecting L. tropica as the causative organism in India and El-Beshbishy's¹² studies showed that kDNA PCR had 90.7% sensitivity to identified L. tropica in CL patients from western Saudi Arabia. The kDNA PCR assay is very useful in lesions with low parasite load (e.g., mucocutaneous leishmaniasis). PCR also has proven to be a very successful tool in molecular diagnostics in the field (e.g. detection of parasite DNA in blood, tissue smears, in samples taken on filter paper, etc.) without parasite isolating and enabling determination of the infecting species of New World Leishmania in a relatively short time.^5,13

In this study parasitological diagnosis procedures, such as medium cultures as well as DNA analysis using PCR, were used to establish the accurate diagnosis of CL and identification of Leishmania species over a period of two years (2002-2004) in Calakmul municipality, Campeche state, Mexico.

 

Materials and methods

Study area. The study area was the forest of the state of Campeche, Mexico. LC is endemic to this area. Calakmul, the largest municipality located in the state of Campeche, is situated in the most southern part of the Yucatan Peninsula, bordering with Guatemala and Belize. Calakmul is located within the Peten biogeographic province, which also comprises northern Guatemala and Belize.¹⁴ Weather in the region is classified as hot and sub-humid, with a marked period of drought (March–June), followed by a rainy season.¹⁵ The mean annual temperature is >22°C and an average annual rainfall in the range of 1439–1561 mm. Vegetation in the region is described as medium sub-perennial forest, which is characterized by three strata consisting of trees of 4–12 m, 12–22 m and 22–35 m in height.¹⁶

Ethical considerations. Informed consent was obtained from all the adults who participated in the study. Consent for inclusion of young children was obtained from parents or guardians. This study was reviewed and approved by the Ethics Committee of the Health Authorities of Calakmul Municipality, Campeche, Mexico, in agreement with the International Ethic Guidelines for Biomedical Research Involving Human Subjects and the Norma Oficial Mexicana de Salud: NOM-003-SSA 2-1993, for sampling blood from human beings for diagnosis and therapeutics. The study was registered in the "Libro de Actas del Cabildo" with date May 24, 2002.

Patient population. One hundred and forty-six individuals with skin lesions suggestive of Leishmania infection were studied. Patients from sixteen villages of the municipality Calakmul of Campeche state in the Yucatan Peninsula, Mexico (table I and table II), were evaluated during a 2-year period (2002–2004).

Characterization of parasites. Needle aspirates were taken from the edge of cutaneous lesions, 100 µL of each aspirate was inoculated in Senekjie's medium and stored at 24°C for isolation of Leishmania promastigotes.

Leishmania reference strains and culture conditions. The following strains were used as positive controls: L. (Viannia) panamensis LS94 (MHOM/PA/71/LS94), L. (Leishmania) mexicana M379 (MHOM/BZ/62/M379), L. (Leishmania) mexicana Bel 21 (MHOM/BZ/82/BEL21), and L. (Leishmania) mexicana MC (MHOM/MX/88 HRCMC). The Leishmania strains were cultured in RPMI medium supplemented with 10% fetal calf serum at 24°C.

DNA extraction. DNA from 100 µL of sample aspirates was extracted by adding NET 100 (100mM Tris-HCl pH8, 100mM EDTA pH8, 100mM NaCl) and 1% SDS, centrifuged at 200g for 10 min at 4°C. DNA from Leishmania cultures was prepared by centrifuging 108 parasites of exponential phase of growth at 2000g for 10 min at 4ºC. The DNA was extracted from the pellet using the High Pure PCR template preparation kit (Roche Diagnostics), following the manufacturer's instructions. The DNA was stored at −20°C until used.

Polymerase chain reaction. The primers AJS1 (GGGGTTGGTGTAAAATAG) and DeB8 (CCAGTTTCCCGCCCCG), specific for kDNA minicircles of the Leishmania subgenus,¹⁷ the LMO1 (TTGGTGTAAAATAGGATGGG) and LMO2 (TTGGGGAAATTATGAACGG) primers, specific for minicircles of Mexican L. (L.) mexicana strains (Mx L. mexicana),¹⁸ the B1 (GGG GTT GGT GTA ATA TAG TGG and B2 (CTA ATT GTG CAC GGG GAG G) specific for species of L. braziliensis complex¹⁹ were used to amplify kDNA from reference strains and from Mexican aspirates. PCR amplifications were performed in a solution of 0.2 mM of each deoxyribonucleotide (Invitrogen Life Technologies, Carlsbad, CA, USA), 50 pmol of each specific primer, 2.5 units of Taq DNA polymerase (Perkin Elmer Cetus), 100 ng of DNA template, 1.5 mM of MgCl2 in a final volume of 100 µL. Samples were denatured at 96°C for 6 min. PCR (35 cycles) consisted of annealing at 60°C for the AJS1 and DeB8 primers, 64°C for the LMO1 and LMO2 primers, and 63°Cfor the B1 and B2 primers, with a 1 min extension at 72°C and a final extension at 72°C for 10 min on a GeneAmp PCR System Model 9700 thermal cycler (Applied Biosystems, Foster City, CA, USA). PCR products (10 µL) were fractionated by electrophoresis in 2% agarose gels in TBE (90 mMTris-HCl pH 8.3, 90 mM boric acid, and 2mM EDTA), stained with ethidium bromide (10mg/mL), and were observed under a transilluminator (SIGMA Chemical Co., St. Louis, MO, USA).

Administration of meglumine antimoniate (Glucantime^®). A total of 111 CL diagnosed patients accepted treatment with meglumine antimoniate (Glucantime). Glucantime is marketed in 5-ml ampules containing 1.5 grams of N-methyl-glucamine antimoniate, which corresponds to 425 mg of Sb51.Treatment consisted in one ampule by intramuscular injection per day until healing.²⁰

 

Results

Parasite culture detected sixty-two of the positive samples giving 42% of sensitivity (data not shown).

From the total group of patients with skin lesions suggestive of CL analyzed by kDNA PCR, 111/146 (76%) samples were positive for CL diagnosis, from these 99 (89%) were amplified with the AJS1 and DeB8 primers specific for the Leishmania subgenus, giving an amplification band typical of L. (L.) mexicana (not shown); 16 (14.4%) of these samples were also amplified with the primers specific for minicircles of Mexican strains of L. (L.) mexicana (table I).

DNA from eight (7.2%) samples of infected individuals was amplified with primers specific for the L. braziliensis complex and four (3.6%) were amplified with both primers specific for the Leishmania subgenus, giving an amplification band typical of L.(L.) mexicana and primers specific for L. braziliensis complex members (table I).

A complete response to treatment was defined as a complete re-epithelization of all lesions with no residual erythema and no relapses during the monthly follow-ups for a period of two years. Of the patients diagnosed with CL and treated with meglumine antimoniate 105/109 (96%) were cured in response to treatment.

 

Discussion

Leishmaniasis is considered by many experts to be an emergent disease in some areas and in others as a re-emergent disease because over the last 20 years the number of cases of all forms of leishmaniasis throughout the world has soared.^2,6,21 In the present study conducted over two years in 146 patients with cutaneous lesions from several villages in Calakmul, 76% of them were diagnosed as CL, of those 38% were children and 62% adults (table I and II) (figures 1a, 1b and 1c).

The parasite culture detected only 42% of the CL positive samples. This result agrees with those found for Kumar¹¹ in India where 48.2% of positive samples with Leishmania tropica were detected, and Beshbishy's¹² studies in Western Saudi Arabia where 39.2% of the positive culture samples as well as Leishmania tropica were found. This result could stem from several factors: 1) contamination with associated bacterial infection in the aspirate sample from the lesion; 2) the ambient temperature in the field is high and if an incubator is not available the Leishmania parasite can die; and 3) the primary cultivation of Leishmania braziliensis complex members is not easy to perform.

The diagnosis and identification of Leishmania species as provided by kDNA-PCR amplification detected in the villages of Northern Calakmul was the following: 43% of cases infected with L. mexicana, 25% of cases with L. braziliensis complex members, 62% of mixed infection of Mx L. mexicana + L. (L.) mexicana and 25% of cases infected with L. braziliensis complex + L. (L.) mexicana. From this part of Calakmul in Union 20 de Junio (locally referred to as La Mancolona) cases infected with each of these strains of Leishmania were found (table I). In central Calakmul kDNA PCR assay detected 15% of the cases infected with L. (L.) mexicana, 25% of the cases with L. braziliensis complex members, 37% of the cases infected with Mx L. mexicana L. (L.) mexicana but cases with mix of L. braziliensis complex + L. (L.) mexicana were not detected (table I).

In southern Calakmul 25.3% of the cases infected with L. (L.) Mexicana were detected, 62% of the total infected with L. braziliensis complex members were found, 25.3% of the cases infected with L. (L.) mexicana were detected also in the same region, 75% of cases with L. (L.) mexicana + L. braziliensis complex members, but cases infected with Mx L. mexicana + L. (L.) mexicana were not found (table I).

Regarding skin lesions, in most of the patients they were rounded and ulcerated, with elevated borders and necrotic center. There were no cutaneous metastases and neither lymphatic involvement nor mucosal involvement was observed in any of the 111 cases (figures 1a, 1b and 1c). There was no a special pattern in the site nor in the number of lesions in relation to the Leishmania species and patients' age, as in 15% of cases lesion was on the face, on the ear in 30%, on the arms in 36.6% and on the legs in 18.2%, this results agree with those of Andrade-Narvaez²² (table I).

The village most severely affected with CL was Dos Lagunas Sur, located in the southern part of Calakmul, close to the border of Belize, with 12.3% prevalence, (figure 2c), where most of the cases of CL caused by L. braziliensis and mixed infection with L. braziliensis and L. mexicana were found. People in this village farm chili crops around their houses, which are located very close to the forest, and the population affected includes all of its sectors: children (50%), women, men and the elderly (50%) (tables I and II).

In central Calakmul, La Guadalupe village had the highest prevalence rate (2.2%) and children were the most affected (67%) (table II).

In northern Calakmul the most affected communities were La Mancolona with a 6.5% prevalence, and other nearby cities: La Virgen, with 3.7% and El Carmen, with 2.2% of prevalence, respectively (table II). These villages are located 3-4 km away from the crops and are more urbanized due to deforestation (figure 2a). The most severely affected population for CL in these villages were mainly adult males (66%) who traveled every day to work the crops near the forest (table II).

On the other hand, treatment of CL patients with Glucantime was successful in 96% of those who accepted the treatment, regardless of the number and location of lesions, and number of doses taken. The doses needed to obtain complete healing of lesions varied in children from 2 to 20 and in adults from 2 to 67 ampules (table III). Two patients, one child from Narciso Mendoza (14 years old) and one adult from Dos Naciones (30 years old) were cured spontaneously. No statistically significant difference was observed among patients infected with L. (L.) mexicana and those infected with L. (V.) braziliensis, mix infection with L. (L.) mexicana + L. braziliensis complex or Mx L. mexicana + L. (L.) mexicana (data no shown). The daily dose of 425 mg of Sb51/day was well tolerated in all cases (data no shown), these results agree with those found in Vargas-Gonzalez.²⁰

Among the conditions that have been reported as risk factors by several authors, that explain the permanent presence, spread, and increase of CL cases in Calakmul, Campeche and the presence of L. braziliensis complex, which is restricted mainly to the primary forest, as well as the mixed infections, the present study and other authors found mainly: 1) human colonization of large areas of previously untouched forests, for example migration to Calakmul of people from other states of Mexico and mainly people from Guatemala, where CL caused by L. braziliensis complex members is endemic,^23,24 as well as urbanization and deforestation, by which transmission cycles are adapting to peridomestic environments and are spreading to previously no endemic areas with domestic animals as potential reservoirs (figures 2a, 2b and 2c);²⁵ 2) spending nocturnal periods in the forest for cultivation of agricultural crops (e.g., chilli and coffee);^26,27 and 3) with the increase of military troop maneuvers, soldiers have become another high-risk group.²⁸ All this ecological, social, and educational conditions are still occurring at the present time in Calakmul.

Furthermore Canto-Lara²⁹ identified L. (L.) mexicana in four species of wild rodents: the black-eared rice rat, Oryzomys melanotis; the hispid cotton-rat, Sigmodon hispidus; the big-eared climbing rat, Oryzomys phyllotis; and the Yucatan deer-mouse, Peromyscus yucatanicus. Moreover it has been demonstrated that reservoir mammals of several orders can be infected with the same Leishmania species.² Regarding the vectors Pech-May,³⁰ they found in Dos Lagunas Sur L. mexicana infections in two sandfly species, Lu. shannoni and Lutzomyia ylephiletor, whereas in La Mancolona they found infections in Lu. shannoni, Lu. cruciata, Lu. o. olmeca and Lu panamensis.

In conclusion, zoonotic cutaneous leishmaniasis (ZCL) caused by L. (mexicana) and L. braziliensis complexes, in foci located in Central and South America including Mexico, is disseminating due to urbanization and new settlements, as it has occurred in Calakmul. As it was stablished by Desjeux³¹ these factors are making ZCL a growing public health concern for many countries of the American continent. The findings in the present study showed that CL is still an important public health concern in the Municipality of Calakmul, Campeche, Mexico. This is due maybe to ecological, social and educational conditions favorable to the permanence and transmission of LC.

 

Acknowledgments

Financial support for this research was provided by Direccion de Servicio Social y Egresados, Instituto Politecnico Nacional, Mexico, and Servicios de Salud del Ayuntamiento de Calakmul. Amalia Monroy-Ostria was fellow of Conacyt, EDI, COFAA, Mexico. Mirsha P. Hernandez Rivera was fellow of Conacyt Mexico. We thank Sebastian Mendez Arcos and Miguel Sanchez Lopez for technical assistance.

 

References

1. World Health Organization. Fact sheet No. 375 2014.         [ Links ]

2. Reithinger R, Dujardin JC, Louzir H, Pirmez C, Alexander B, Brooker S. Cutaneous leishmaniasis. Lancet Infect Dis 2007;7:581-596.         [ Links ]

3. Lainson R, Shaw JJ. New World Leishmaniasis. In: Cox FEG, Wakelin D, Gillespie SH, Despommier DD, eds. Topley & Wilson's Microbiology and Microbial Infections, 10th ed. London: Wiley & Blackwell, 2005:313-349.         [ Links ]

4. Convit J, Ulrich M, Fernandez CT, Tapia FJ, Cáceres-Dittmar G, Castés M, Rondón AJ. The clinical and immunological spectrum of American cutaneous leishmaniasis. Trans R Soc Trop Med Hyg 1993;87:444-448.         [ Links ]

5. Hernandez MO, Monroy OA, McCann S, Barker DC. Identification of Mexican Leishmania species by analysis of PCR amplified DNA. Acta Trop 1998;71:139-153.         [ Links ]

6. Ashford RW. The leishmanaisis as emerging and reemerging zoonosis. Int J Parasitol 2000;30:1269-1281.         [ Links ]

7. Seidelin H. Leishmaniasis and babesiasis in Yucatán. Ann Trop Med Parasit 1912;6:295-299.         [ Links ]

8. Andrade-Narvaez F, Simmonds DE, Rico A S. Incidence of localized cutaneous leishmaniasis (chiclero's ulcer) in Mexico. T Roy Soc Trop Med H 1990;84:219-220.         [ Links ]

9. Beltran E, Bustamante M. Datos epidemiológicos acerca de la úlcera de los chicleros (leishmaniasis americana) en México. Rev Inst Salub Enferm Ttrop 1942;3:1-28.         [ Links ]

10. Canto-Lara SB, Cardenas-Maruffo M F, Vargas-Gonzalez A, Andrade-Narvaez F. Isoenzyme characterization of Leishmania isolated from human cases with localized cutaneous leishmaniasis from the State of Campeche, Yucatan Peninsula, Mexico. Am J Trop Med Hyg 1998;4:444- 447.         [ Links ]

11. Kumar R, Bumb RA, Ansari NA, Mehta Rd, Salotra P et al. Cutaneous Leismaniasis caused by Leishmania tropica in Bikaner, India: Parasite identification and characterization using molecular and immunologic tools. Am J Trop Med Hyg 2007;76:896-901.         [ Links ]

12. El-Beshbishy HA, Al-Ali KH, El-Badry AA. Molecular characterization of cutaneous leishmaniasis in Al-Madinah Al-Munawarah province, Western Saudi Arabia. Int J Infectious Diseases 2013;17:334-338.         [ Links ]

13. Reithinger R, Dujardin JC. Molecular diagnosis of leishmaniasis: current status and future applications. J Clin Microbiol 2007;45:21-25.         [ Links ]

14. Espinosa-Organista D, Morrone J, Aguilar-Zúñiga C, Llorente-Bousquets J. Regionalización biogeográfica de México: Provincias bióticas. In: Llorente-Bosquets JE, González-Soriano E, Papavero N, ed. Biodiversidad, taxonomía y biogeografía de artrópodos de México: hacia una síntesis de su conocimiento. Mexico: Universidad Nacional Autónoma de México, 2000:61-101.         [ Links ]

15. García E. Diversidad climático vegetal en México. Biodiversidad, taxonomía y biogeografía de artrópodos de Mexico: hacia una síntesis de su conocimiento. En: Llorente-Bousquets J, García-Aldrete N, González-Soriano E, ed. México: Instituto de Biología (UNAM)/ Comisión Nacional para el Conocimiento y Uso de la Biodiversidad, 1996:15-25.         [ Links ]

16. Flores JS, Espejel-Carvajal I. Tipos de vegetación de la Península de Yucatán. Etnoflora yucatanense. Mérida, Yucatán: Universidad Autónoma de Yucatán, 1994.         [ Links ]

17. Smyth AJ, Ghosh A, Hassan MQ, Basu D, De Bruijn MHL, Adhya S, et al. Rapid and sensitive detection of Leishmania kinetoplast DNA from spleen and blood samples of Kala-azar patients. Parasitology 1992;105:183-192.         [ Links ]

18. Hernandez MO. Diseño de herramientas moleculares para el estudio de la heterogeneidad genética de aislados de Leishmania mexicana (thesis). Mexico: Escuela Nacional de Ciencias Biológicas, Instituto Politecnico Nacional, 2000.         [ Links ]

19. De Bruijn MHL, Barker DC. Diagnosis of New World leishmaniasis: specific detection of species of the Leishmania braziliensis complex by amplification of kinetoplast DNA. Acta Trop 1992;52:45-58.         [ Links ]

20. Vargas-Gonzalez A, Canto-Lara SB, Damian-Centeno AG, Andrade-Narvaez FJ. Response of cutaneous leishmaniasis (Chiclero's Ulcer) to treatment with meglumine antimoniate in Southeast Mexico. Am J Trop Med Hyg 1999;61:960-963.         [ Links ]

21. Shaw J. The leishmaniasis survival and expansion in a changing world. Mem I Oswaldo Cruz 2007;102:541-547.         [ Links ]

22. Andrade-Narváez FJ, Vargas-González A, Canto-Lara SB, Damián-Centeno AG. Clinical Picture of Cutaneous Leishmaniases Due to Leishmania (Leishmania) mexicana in the Yucatan Peninsula, Mexico. Mem I Oswaldo Cruz 2001;96:163-167.         [ Links ]

23. Biagi FF, Marroquin F, Gonzalez A. Distribución geográfica de la leishmaniasis cutánea en México. Medicina 1938;38:444-446.         [ Links ]

24. Zavala-Velazquez J. Leishmaniasis in Yucatán. Gac Med Mex 1972;104:1-9, 21-25.         [ Links ]

25. Lainson R. The American leishmaniasis: some observations on their ecology and epidemiology. T Roy Soc Trop Med H 1983;77:569-596.         [ Links ]

26. Sanchez-Tejeda G, Rodriguez N, Parra CL, Hernández MO, Barker DC, Monroy OA. Cutaneous Leishmaniasis caused by Members of Leishmania braziliensis Complex in Nayarit, State of Mexico. Mem I Oswaldo Cruz 2001;96:15-19.         [ Links ]

27. Alexander B, Agudelo LA, Navarro JF. Relationship between coffee cultivation in Colombia and exposure to Leishmania. T Roy Soc Trop Med H 2009;103:1263-1268.         [ Links ]

28. Andrade-Narvaez F, Valerio-Castro E, Simmonds DE. Leishmaniasis cutánea mexicana: Índice alérgico en una población militar ubicada en una zona endémica. Rev Sanid Milit Mex 1985;39:52-154.         [ Links ]

29. Canto-Lara SB, Van Wynsberghe NR, Vargas-González A, Ojeda-Farfán FF, Andrade-Narváez FJ. Use of monoclonal antibodies for the identification of Leishmania spp. Isolated from humans and wild rodents in the State of Campeche, Mexico. Mem I Oswaldo Cruz 1999;94:305-309.         [ Links ]

30. Pech-May A, Escobedo-Ortegon FJ, Berzunza-Cruz M, Rebollar-Tellez EA. Incrimination of four sandfly species previously unrecognized as vectors of Leishmania parasites in Mexico. Med Vet Entomol 2010;24:150-161.         [ Links ]

31. Desjeux P. Leishmania and the Leishmaniasis: Worldwide increasing risk factor for leishmaniasis. Med Microbiol Immun 2001;190:77-79.         [ Links ]

 

Received on: December 6, 2013
Accepted on: November 19, 2014

 

Corresponding author:
Dra. Amalia Monroy-Ostria.
Escuela Nacional de Ciencias Biológicas, Instituto Politécnico Nacional.
Carpio y Plan de Ayala. 11340 Mexico DF, Mexico.
E-mail: amaliahmo@gmail.com

 

Declaration of conflict of interests. The authors declare that they have no conflict of interests.